Pricing & Availability

Clone

10/FR2 (See other available formats)

Regulatory Status

RUO

Other Names

FR-β

Isotype

Rat IgG2a, κ

Ave. Rating

Submit a Review

Product Citations

publications

• 

Compare all formats

Technical data sheet

Product Details

Reactivity

Mouse

Antibody Type

Monoclonal

Host Species

Rat

Immunogen

Mouse Folate receptor β transfected cells

Formulation

Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide.

Preparation

The antibody was purified by affinity chromatography.

Concentration

0.5 mg/ml

Storage & Handling

The antibody solution should be stored undiluted between 2°C and 8°C.

Application

FC – Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis

Application References

(PubMed link indicates BioLegend citation)

1. Nagai T, et al. 2009. Cancer Immunol Immunother. 1577-86.

RRID

AB_2687271 (BioLegend Cat. No. 153302)

Antigen Details

Structure

30 kD, seven disulfide bonds

Distribution

Placenta, monocytes, tissue resident macrophages

Function

Transport of folate into cells

Ligand/Receptor

Folic Acid

Cell Type

Macrophages, Monocytes

Antigen References

1. Elwood PC, 1989, J Biol Chem, 264:14893.
2. Shen F, et al, 1994, Biochemistry, 8;33:1209.
3. Yi YS, 2016, Immune Netw,16:337.

Gene ID

14276 View all products for this Gene ID

UniProt

View information about Folate Receptor β on UniProt.org

Related Products

Related FAQs

There are no FAQs for this product.

Other Formats

View All Folate Receptor β Reagents Request Custom Conjugation

Pricing & Availability

Clone

10/FR2 (See other available formats)

Regulatory Status

RUO

Other Names

FR-β

Isotype

Rat IgG2a, κ

Barcode Sequence

CTCAGATGCCCTTTA

Ave. Rating

Submit a Review

Product Citations

publications

Technical data sheet

Product Details

Reactivity

Mouse

Antibody Type

Monoclonal

Host Species

Rat

Immunogen

Mouse Folate receptor β transfected cells

Formulation

Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA.

Preparation

Concentration

0.5 mg/ml

Storage & Handling

The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

Application

PG – Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysisSolutions.

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)

1. Nagai T, et al. 2009. Cancer Immunol Immunother. 1577-86.

RRID

AB_2800690 (BioLegend Cat. No. 153307)

Antigen Details

Structure

30 kD, seven disulfide bonds

Distribution

Placenta, monocytes, tissue resident macrophages

Function

Transport of folate into cells

Ligand/Receptor

Folic Acid

Cell Type

Macrophages, Monocytes

Antigen References

1. Elwood PC, 1989, J Biol Chem, 264:14893.
2. Shen F, et al, 1994, Biochemistry, 8;33:1209.
3. Yi YS, 2016, Immune Netw,16:337.

Gene ID

14276 View all products for this Gene ID

UniProt

View information about Folate Receptor β on UniProt.org

Related Products

Related FAQs

TotalSeq™ is BioLegend’s brand of antibody-oligonucleotide conjugates, to enable simultaneous analysis of proteins and mRNA in single cells. CITE-seq and REAP-seq are two similar workflows for simultaneous protein and mRNA analysis, and the TotalSeq™ conjugates integrate seamlessly into these established protocols.

The main difference between the 3 formats relates to the sequences of the oligo tags and their downstream compatibility with single-cell sequencing platforms.

• TotalSeq™-A reagents use a poly-A capture method that is instrument agnostic which includes the 10x Genomics 3’ Single Cell Gene expression kit.
• TotalSeq™-B utilizes the feature barcode technology for 10x Genomics 3’ Single Cell Gene expression kit.
• TotalSeq™-C also uses the feature barcode technology but for 10x Genomics 5’ V(D)J expression kit.

They each use different primers for library amplification. You can read a little more about the differences on our TotalSeq™ webpage.

We are not currently able to support the mixing of TotalSeq™-A and TotalSeq™-B reagents in a single experiment. These two product lines require different protocols for library prep, and the different capturing methods may cause discrepancies in capture efficiency. In addition, it can often cause issues downstream in the bioinformatics portion when analyzing your data due to the variations in index sequences and lengths. In theory, they should work together, but in practice it can be quite difficult and we advise against doing so whenever possible.

Either will work fine.

When discussing single-cell data, features are any aspect of the cell that is being measured. Common features are mRNA, protein, sgRNA, etc.

TotalSeq™-A/B/C products are fully supported by BioLegend and have been internally tested by BioLegend on the 10x Genomics platform. TotalSeq™-B and C are fully supported by 10x Genomics. 10x Genomics provides limited support for TotalSeq™-A.

If you are unsure about which technical service team to contact if you have questions or issues, feel free to reach out to BioLegend and we will work with our partners to resolve your problem or answer your technical questions.

What are “Hashtags”?

Hashtag reagents are intended to be used for sample barcoding, which allows users to combine multiple samples into a single lane, then de-multiplex during analysis. Instead of select antigen-specific antibodies, the hashtags are designed so that they are specific for human or mouse cells, and to cover as many cells as possible. For human samples, the hashtags are made of two antibodies that recognize ubiquitous surface markers, CD298 and β2 microglobulin, each conjugated to the same oligonucleotide containing the barcode sequence. For mouse samples, the surface markers are CD45 and H-2 MHC class I. The conjugates are already pre-mixed and ready to use.

Hashing allows customers to run multiple samples in a single lane of a 10x Genomics Chromium instrument, or equivalent, which optimizes the number of cells or samples that can be analyzed simultaneously. This can reduce variability due to batch effects or sample handling. It can also help to identify doublets more efficiently. Furthermore, it can also improve yield and help with cell input when cell numbers are low, therefore optimizing the use of the platform and your workflow or protocol.

Typically, when using a single-cell platform, as you increase the amount of input cells, the rate of doublets (two cells captured as one data point) increases. This leads to an unacceptable percentage of datapoints that contain more than one cell. Hashtags allows you to “super load” the number of cells. To this end, multiple aliquots of the same sample could be stained with as many hashtags as aliquots you’d wish to mix. The number of aliquots and number of cells per aliquot may vary, but after washing and mixing the cells, following the staining and analysis protocol, if more than one hashtag is detected in a single-cell “event”, that event can be safely discarded as a doublet. This does not eliminate doublets that contain the same hashtag but the rate of doublet detection is greatly increased. However, “super loading” should be carefully controlled as the more cells you load the more doublets occur, causing diminishing returns overall. There should be a balance between multi-sample optimization, single-cell data yield, and optimal instrument/platform performance.

What are nuclear hashtags?

Nuclear hashtags are used for single-nucleus RNA-seq (snRNA-seq) samples. snRNA-seq captures RNAs that are isolated with the nucleus. This is done because whole, intact cells may be difficult to isolate due to specific experimental or sample conditions, or to answer a specific scientific question. See an example of nuclear hashtag application in this paper: https://www.nature.com/articles/s41467-019-10756-2

Can I use nuclear hashtags for single cell ATAC-seq?

Unfortunately, our TotalSeq™ reagents are not directly compatible with single ATAC-seq kits at this time. However, the NYGC has pioneered a bridging method ATAC with Select Antigen Profiling by sequencing (ASAP-seq) which is able to bridge TotalSeq™ antibodies with other capture platforms such as scATAC-seq. https://www.biorxiv.org/content/10.1101/2020.09.08.286914v1

Our nuclear hashtag products available off the shelf, but we do not currently have a recommended protocol for this application at this time.
The only recommendations we can provide are literature references such as this one:
https://www.nature.com/articles/s41467-019-10756-2

Can I get technical support when using hashtags?

Hashtags can absolutely be used in any single cell platform including the 10x Genomics platform. BioLegend fully supports the usage of hashtags. Please contact our technical service group for more information.

We have not tested this, but there is no reason to believe that non-competing clones for the same target would be problematic. Similarly, a sub-saturating concentration of both reagents against the same target should be tolerated by the cell/technique. The original CITE-seq paper by Stoeckius et al.(Fig. 2) demonstrated that cells can be co-stained for downstream analyses. Although the authors did not use current TotalSeq™ reagents, the technology is the same. In addition, other CITE-seq users have also demonstrated this approach. Please contact our technical service group for more information.

Why is it essential to remove dead cells prior to subjecting samples for CITE-seq?

We recommend >95% viability before beginning you CITE-seq experiment. Running dead cells during CITE-seq essentially leads to “wasting” single cell runs on dead cells, which may ultimately lead to sub-optimal data, or not processing enough cells to pick up the positive events, especially if the frequency of your target cell is very low. Dead cells can also be removed using magnetic beads. If performing CITE-seq before eliminating dead cells is required, it is possible to use bioinformatics methods to try to clean up low quality events (which may include dead cells). This could be a more complex approach, but in such cases, we recommend the following reading:

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4758103/
https://www.ncbi.nlm.nih.gov/pubmed/28045081

Is it necessary to sort samples prior to CITE-seq? What should I consider when deciding to pre-sort, or not?

If the populations of interest can be clustered/identified without sorting, the likelihood that you need to pre-sort is minimal. However, if the cell number in the cluster is very small, it may not be sufficient to draw conclusions when compared to control, or other cell populations. In which case, enrichment of this population prior to CITE-seq analysis may help with obtaining more meaningful sequencing data that is selective for your rare cell population(s) of interest. We also recommend to sort out dead cells if the viability in a sample is lower than 95%.

We have developed pre-titrated, lyophilized TotalSeq™ panels to facilitate the use of combined antibodies. We have panels in all three formats (TotalSeq™-A, B, and C) designed to identify the main immune cells, as well as a universal panel that contains antibodies against 130 protein targets, and 7 isotype controls. We will keep on releasing these pre-optimized panels as we understand that titrating dozens of antibodies for this application is not an easy task. We may not be able to provide specific titration values for individual antibodies as that may depend on multiple factors. However, here are some recommendations in case you may not be able to use our panels, and need to perform your own titrations:

1. Performing titrations using the actual CITE-seq method is costly, but using hashtags can make the process more affordable. See Fig. 3 and associated methods of this publication for more information.
2. Perform flow cytometry experiments to find the optimal antibody concentration, using the same clone conjugated to PE. The flow cytometry antibody amount should translate well to CITE-seq.
3. Label the cells with different concentrations of a TotalSeq™ antibody, and then use a poly(dT) oligo conjugated to a fluorophore, such as Alexa Fluor® 647, as a secondary reagent to detect the TotalSeq™ antibody. This is a more direct method, but it requires the use of the actual TotalSeq™ antibody.

What tools are available for data analysis?

Some available resources include CITE-Seq-Count, and the tools developed by the Rahul Satija laboratory. Please contact our technical service group for further information.

I need to order primers; where do I order them and what purity is needed?

There are several companies offering primer synthesis. We can recommend IDT technologies. For additive primers, desalt purification is sufficient. For index primers, either HPLC or PAGE is needed.

Why should I generate ADT/HTO libraries separate from mRNA?

Separate ADT/HTO and mRNA libraries provide flexibility when sequencing. Libraries can be mixed at different ratios before sequencing depending on the number of reads needed. Typically, ADT/HTO libraries require less sequencing depth compared to their mRNA counterparts.

How is the oligo tag bound to the antibody so that it does not interfere with antibody binding to target protein?

The oligo is attached to the antibody in the same method as some of our fluorophore-conjugated antibodies that are quality tested by flow cytometry. Once the antibodies have been conjugated to the oligonucleotide, we verify by flow cytometry that the antibody can still bind to its target. This is part of our quality control process for TotalSeq™ conjugates.

Not in the same experiment; it is not possible because CyTOF® requires its own instrument and protocol, and it destroys the sample in the process. To do so, it is necessary to split the sample and run both CyTOF® and CITE-seq assays. Note that CITE-seq generates equivalent data for surface proteins as CyTOF® with higher panel multiplexing capabilities and at a single-cell level.

Can CITE-seq be extended to micro-RNAs?

This is a technically challenging application as micro-RNAs are very small, and in many cases will be as small as or even smaller than the required primers to execute the protocol. It is not possible at the moment.

Yes, the protocol to perform bulk epitope and nucleic acid sequencing (BEN-seq) has been developed as a collaboration between Illumina and BioLegend. You can read more about it in our application note.

Is autofluorescence an issue as in flow cytometry?

No, sequencing as the final readout is not affected by cell autofluorescence.

This has to do mostly with antibody affinity, titration, and level of antigen expression. BioLegend and some collaborators are working on titration data. There is also some data already published. In theory, as long as the antibody can bind one molecule, PCR amplification and sequencing should pick it up, but there is always background noise. A common way to control for this is to add negative cells to your experiment. For example, if working with human PBMCs, use mouse cells and vice versa.

How many cells do you need per experiment?

This depends on the biological question that needs to be answered. From the technical perspective, when using 10x Genomics Chromium, it is recommended to load 5,000 – 10,000 cells per lane. The use of hashtags can increase that number. For ease of staining, we typically recommend 1 million cells, but this number also depends on availability of cells and the operator’s ability to handle low cell numbers.

We have optimized multiple pre-mixed antibody cocktails, including TotalSeq™-A, -B, or -C Human TBNK that contain 9 antibodies and our TotalSeq™-C Human Universal Cocktail, v1.0 which contains an unprecedented 130 target antibodies plus 7 isotype controls in a single vial. We will be releasing more panels in the near future. The literature suggests that panels larger than these cocktails are possible. For example, Yapeng et al. published a study using 197 TotalSeq™ antibodies and 7 isotype controls. BioLegend and the scientific community keep pushing the upper limits of multiplexed protein detection by sequencing and have yet to find one.

Is it possible to do FACS sorting first then do CITE-Seq, while performing both antibody-oligo and antibody-fluorophore labelling at the same time? Will the oligo conjugate withstand sorting?

The oligo should withstand sorting. However, based on theoretical considerations we recommend using non-competing clones, to minimize impact in either FACS or sequencing signal/reading. Even if exposed for a very short time, we have not evaluated the effect of ultraviolet or violet lasers on the oligo conjugates. An alternative to flow sorting could be negative magnetic bead enrichment, such as our MojoSort™ platform.

What should be my sequencing depth be for my ADT/HTO library?

We recommend a sequencing depth of 5,000 reads/cell. If you are using more than 100 TotalSeq™ antibodies, you should increase to 10,000 reads/cell. For HTOs alone, 500 reads/cell is sufficient.

Do I need isotype controls?

Isotype controls are highly recommended but not required. The utility of isotype controls in these applications is that they can help identify “sticky cells” caused by cells with compromised viability. Isotype controls also provide an overall picture of the background level or non-specific binding of different cell types. Typically when running isotype controls for CITE-seq assays, you want to include 1 isotype control for every isotype included in the panel, regardless of how many antibodies there are. We recommend using the isotype control at a concentration matching the highest concentration of a single antibody used in a panel, for that particular isotype. Typically, the isotype controls should be used in the same tube as the panel itself. Unlike a traditional flow cyometry experiment, the isotype controls for multiomics cell characterization do not need their own separate samples for comparison. Isotype controls are included in our TotalSeq™ Universal Cocktails.

Another useful control to help identify positive signals are cells known to not bind the antibodies used. For example, murine cells when characterizing human samples, as long as the antibodies do not cross-react between mouse and human targets. This, however, is not required to confidently identify positive signals.

Should I use dextran sulfate to block?

Several genomics protocols, including some from 10x Genomics, may recommend including dextran sulfate as a blocker to prevent unwanted charge interactions between nucleic acids and other positively charged molecules. However, we have found that in some cases, the inclusion of dextran sulfate can interfere with antibody binding and recognition and we do not recommend using it with any of our TotalSeq™ reagents. It’s unclear what is the exact mechanism of action that causes this issue. All our protocols reflect this observation; thus we do not recommend the use of dextran sulfate.

Other Formats

View All Folate Receptor β Reagents Request Custom Conjugation

Pricing & Availability

Clone

10/FR2 (See other available formats)

Regulatory Status

RUO

Other Names

FR-β

Isotype

Rat IgG2a, κ

Barcode Sequence

CTCAGATGCCCTTTA

Ave. Rating

Submit a Review

Product Citations

publications

Technical data sheet

Product Details

Reactivity

Mouse

Antibody Type

Monoclonal

Host Species

Rat

Immunogen

Mouse Folate receptor β transfected cells

Formulation

Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA

Preparation

Concentration

0.5 mg/mL

Storage & Handling

The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

Application

PG – Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysisSolutions.

Additional Product Notes

10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNNNNNN (PCR handle), and NNNNNNNNNGCTTTAAGGCCGGTCCTAGC*A*A (capture sequence). N represents either randomly selected A, C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)

1. Nagai T, et al. 2009. Cancer Immunol Immunother. 1577-86.

RRID

AB_2876511 (BioLegend Cat. No. 153309)

Antigen Details

Structure

30 kD, seven disulfide bonds

Distribution

Placenta, monocytes, tissue resident macrophages

Function

Transport of folate into cells

Ligand/Receptor

Folic Acid

Cell Type

Macrophages, Monocytes

Antigen References

1. Elwood PC, 1989, J Biol Chem, 264:14893.
2. Shen F, et al, 1994, Biochemistry, 8;33:1209.
3. Yi YS, 2016, Immune Netw,16:337.

Gene ID

14276 View all products for this Gene ID

UniProt

View information about Folate Receptor β on UniProt.org

Related Products

Related FAQs

TotalSeq™ is BioLegend’s brand of antibody-oligonucleotide conjugates, to enable simultaneous analysis of proteins and mRNA in single cells. CITE-seq and REAP-seq are two similar workflows for simultaneous protein and mRNA analysis, and the TotalSeq™ conjugates integrate seamlessly into these established protocols.

The main difference between the 3 formats relates to the sequences of the oligo tags and their downstream compatibility with single-cell sequencing platforms.

• TotalSeq™-A reagents use a poly-A capture method that is instrument agnostic which includes the 10x Genomics 3’ Single Cell Gene expression kit.
• TotalSeq™-B utilizes the feature barcode technology for 10x Genomics 3’ Single Cell Gene expression kit.
• TotalSeq™-C also uses the feature barcode technology but for 10x Genomics 5’ V(D)J expression kit.

They each use different primers for library amplification. You can read a little more about the differences on our TotalSeq™ webpage.

We are not currently able to support the mixing of TotalSeq™-A and TotalSeq™-B reagents in a single experiment. These two product lines require different protocols for library prep, and the different capturing methods may cause discrepancies in capture efficiency. In addition, it can often cause issues downstream in the bioinformatics portion when analyzing your data due to the variations in index sequences and lengths. In theory, they should work together, but in practice it can be quite difficult and we advise against doing so whenever possible.

Either will work fine.

When discussing single-cell data, features are any aspect of the cell that is being measured. Common features are mRNA, protein, sgRNA, etc.

TotalSeq™-A/B/C products are fully supported by BioLegend and have been internally tested by BioLegend on the 10x Genomics platform. TotalSeq™-B and C are fully supported by 10x Genomics. 10x Genomics provides limited support for TotalSeq™-A.

If you are unsure about which technical service team to contact if you have questions or issues, feel free to reach out to BioLegend and we will work with our partners to resolve your problem or answer your technical questions.

What are “Hashtags”?

Hashtag reagents are intended to be used for sample barcoding, which allows users to combine multiple samples into a single lane, then de-multiplex during analysis. Instead of select antigen-specific antibodies, the hashtags are designed so that they are specific for human or mouse cells, and to cover as many cells as possible. For human samples, the hashtags are made of two antibodies that recognize ubiquitous surface markers, CD298 and β2 microglobulin, each conjugated to the same oligonucleotide containing the barcode sequence. For mouse samples, the surface markers are CD45 and H-2 MHC class I. The conjugates are already pre-mixed and ready to use.

Hashing allows customers to run multiple samples in a single lane of a 10x Genomics Chromium instrument, or equivalent, which optimizes the number of cells or samples that can be analyzed simultaneously. This can reduce variability due to batch effects or sample handling. It can also help to identify doublets more efficiently. Furthermore, it can also improve yield and help with cell input when cell numbers are low, therefore optimizing the use of the platform and your workflow or protocol.

Typically, when using a single-cell platform, as you increase the amount of input cells, the rate of doublets (two cells captured as one data point) increases. This leads to an unacceptable percentage of datapoints that contain more than one cell. Hashtags allows you to “super load” the number of cells. To this end, multiple aliquots of the same sample could be stained with as many hashtags as aliquots you’d wish to mix. The number of aliquots and number of cells per aliquot may vary, but after washing and mixing the cells, following the staining and analysis protocol, if more than one hashtag is detected in a single-cell “event”, that event can be safely discarded as a doublet. This does not eliminate doublets that contain the same hashtag but the rate of doublet detection is greatly increased. However, “super loading” should be carefully controlled as the more cells you load the more doublets occur, causing diminishing returns overall. There should be a balance between multi-sample optimization, single-cell data yield, and optimal instrument/platform performance.

What are nuclear hashtags?

Nuclear hashtags are used for single-nucleus RNA-seq (snRNA-seq) samples. snRNA-seq captures RNAs that are isolated with the nucleus. This is done because whole, intact cells may be difficult to isolate due to specific experimental or sample conditions, or to answer a specific scientific question. See an example of nuclear hashtag application in this paper: https://www.nature.com/articles/s41467-019-10756-2

Can I use nuclear hashtags for single cell ATAC-seq?

Unfortunately, our TotalSeq™ reagents are not directly compatible with single ATAC-seq kits at this time. However, the NYGC has pioneered a bridging method ATAC with Select Antigen Profiling by sequencing (ASAP-seq) which is able to bridge TotalSeq™ antibodies with other capture platforms such as scATAC-seq. https://www.biorxiv.org/content/10.1101/2020.09.08.286914v1

Our nuclear hashtag products available off the shelf, but we do not currently have a recommended protocol for this application at this time.
The only recommendations we can provide are literature references such as this one:
https://www.nature.com/articles/s41467-019-10756-2

Can I get technical support when using hashtags?

Hashtags can absolutely be used in any single cell platform including the 10x Genomics platform. BioLegend fully supports the usage of hashtags. Please contact our technical service group for more information.

We have not tested this, but there is no reason to believe that non-competing clones for the same target would be problematic. Similarly, a sub-saturating concentration of both reagents against the same target should be tolerated by the cell/technique. The original CITE-seq paper by Stoeckius et al.(Fig. 2) demonstrated that cells can be co-stained for downstream analyses. Although the authors did not use current TotalSeq™ reagents, the technology is the same. In addition, other CITE-seq users have also demonstrated this approach. Please contact our technical service group for more information.

Why is it essential to remove dead cells prior to subjecting samples for CITE-seq?

We recommend >95% viability before beginning you CITE-seq experiment. Running dead cells during CITE-seq essentially leads to “wasting” single cell runs on dead cells, which may ultimately lead to sub-optimal data, or not processing enough cells to pick up the positive events, especially if the frequency of your target cell is very low. Dead cells can also be removed using magnetic beads. If performing CITE-seq before eliminating dead cells is required, it is possible to use bioinformatics methods to try to clean up low quality events (which may include dead cells). This could be a more complex approach, but in such cases, we recommend the following reading:

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4758103/
https://www.ncbi.nlm.nih.gov/pubmed/28045081

Is it necessary to sort samples prior to CITE-seq? What should I consider when deciding to pre-sort, or not?

If the populations of interest can be clustered/identified without sorting, the likelihood that you need to pre-sort is minimal. However, if the cell number in the cluster is very small, it may not be sufficient to draw conclusions when compared to control, or other cell populations. In which case, enrichment of this population prior to CITE-seq analysis may help with obtaining more meaningful sequencing data that is selective for your rare cell population(s) of interest. We also recommend to sort out dead cells if the viability in a sample is lower than 95%.

We have developed pre-titrated, lyophilized TotalSeq™ panels to facilitate the use of combined antibodies. We have panels in all three formats (TotalSeq™-A, B, and C) designed to identify the main immune cells, as well as a universal panel that contains antibodies against 130 protein targets, and 7 isotype controls. We will keep on releasing these pre-optimized panels as we understand that titrating dozens of antibodies for this application is not an easy task. We may not be able to provide specific titration values for individual antibodies as that may depend on multiple factors. However, here are some recommendations in case you may not be able to use our panels, and need to perform your own titrations:

1. Performing titrations using the actual CITE-seq method is costly, but using hashtags can make the process more affordable. See Fig. 3 and associated methods of this publication for more information.
2. Perform flow cytometry experiments to find the optimal antibody concentration, using the same clone conjugated to PE. The flow cytometry antibody amount should translate well to CITE-seq.
3. Label the cells with different concentrations of a TotalSeq™ antibody, and then use a poly(dT) oligo conjugated to a fluorophore, such as Alexa Fluor® 647, as a secondary reagent to detect the TotalSeq™ antibody. This is a more direct method, but it requires the use of the actual TotalSeq™ antibody.

What tools are available for data analysis?

Some available resources include CITE-Seq-Count, and the tools developed by the Rahul Satija laboratory. Please contact our technical service group for further information.

I need to order primers; where do I order them and what purity is needed?

There are several companies offering primer synthesis. We can recommend IDT technologies. For additive primers, desalt purification is sufficient. For index primers, either HPLC or PAGE is needed.

Why should I generate ADT/HTO libraries separate from mRNA?

Separate ADT/HTO and mRNA libraries provide flexibility when sequencing. Libraries can be mixed at different ratios before sequencing depending on the number of reads needed. Typically, ADT/HTO libraries require less sequencing depth compared to their mRNA counterparts.

How is the oligo tag bound to the antibody so that it does not interfere with antibody binding to target protein?

The oligo is attached to the antibody in the same method as some of our fluorophore-conjugated antibodies that are quality tested by flow cytometry. Once the antibodies have been conjugated to the oligonucleotide, we verify by flow cytometry that the antibody can still bind to its target. This is part of our quality control process for TotalSeq™ conjugates.

Not in the same experiment; it is not possible because CyTOF® requires its own instrument and protocol, and it destroys the sample in the process. To do so, it is necessary to split the sample and run both CyTOF® and CITE-seq assays. Note that CITE-seq generates equivalent data for surface proteins as CyTOF® with higher panel multiplexing capabilities and at a single-cell level.

Can CITE-seq be extended to micro-RNAs?

This is a technically challenging application as micro-RNAs are very small, and in many cases will be as small as or even smaller than the required primers to execute the protocol. It is not possible at the moment.

Yes, the protocol to perform bulk epitope and nucleic acid sequencing (BEN-seq) has been developed as a collaboration between Illumina and BioLegend. You can read more about it in our application note.

Is autofluorescence an issue as in flow cytometry?

No, sequencing as the final readout is not affected by cell autofluorescence.

This has to do mostly with antibody affinity, titration, and level of antigen expression. BioLegend and some collaborators are working on titration data. There is also some data already published. In theory, as long as the antibody can bind one molecule, PCR amplification and sequencing should pick it up, but there is always background noise. A common way to control for this is to add negative cells to your experiment. For example, if working with human PBMCs, use mouse cells and vice versa.

How many cells do you need per experiment?

This depends on the biological question that needs to be answered. From the technical perspective, when using 10x Genomics Chromium, it is recommended to load 5,000 – 10,000 cells per lane. The use of hashtags can increase that number. For ease of staining, we typically recommend 1 million cells, but this number also depends on availability of cells and the operator’s ability to handle low cell numbers.

We have optimized multiple pre-mixed antibody cocktails, including TotalSeq™-A, -B, or -C Human TBNK that contain 9 antibodies and our TotalSeq™-C Human Universal Cocktail, v1.0 which contains an unprecedented 130 target antibodies plus 7 isotype controls in a single vial. We will be releasing more panels in the near future. The literature suggests that panels larger than these cocktails are possible. For example, Yapeng et al. published a study using 197 TotalSeq™ antibodies and 7 isotype controls. BioLegend and the scientific community keep pushing the upper limits of multiplexed protein detection by sequencing and have yet to find one.

Is it possible to do FACS sorting first then do CITE-Seq, while performing both antibody-oligo and antibody-fluorophore labelling at the same time? Will the oligo conjugate withstand sorting?

The oligo should withstand sorting. However, based on theoretical considerations we recommend using non-competing clones, to minimize impact in either FACS or sequencing signal/reading. Even if exposed for a very short time, we have not evaluated the effect of ultraviolet or violet lasers on the oligo conjugates. An alternative to flow sorting could be negative magnetic bead enrichment, such as our MojoSort™ platform.

What should be my sequencing depth be for my ADT/HTO library?

We recommend a sequencing depth of 5,000 reads/cell. If you are using more than 100 TotalSeq™ antibodies, you should increase to 10,000 reads/cell. For HTOs alone, 500 reads/cell is sufficient.

Do I need isotype controls?

Isotype controls are highly recommended but not required. The utility of isotype controls in these applications is that they can help identify “sticky cells” caused by cells with compromised viability. Isotype controls also provide an overall picture of the background level or non-specific binding of different cell types. Typically when running isotype controls for CITE-seq assays, you want to include 1 isotype control for every isotype included in the panel, regardless of how many antibodies there are. We recommend using the isotype control at a concentration matching the highest concentration of a single antibody used in a panel, for that particular isotype. Typically, the isotype controls should be used in the same tube as the panel itself. Unlike a traditional flow cyometry experiment, the isotype controls for multiomics cell characterization do not need their own separate samples for comparison. Isotype controls are included in our TotalSeq™ Universal Cocktails.

Another useful control to help identify positive signals are cells known to not bind the antibodies used. For example, murine cells when characterizing human samples, as long as the antibodies do not cross-react between mouse and human targets. This, however, is not required to confidently identify positive signals.

Should I use dextran sulfate to block?

Several genomics protocols, including some from 10x Genomics, may recommend including dextran sulfate as a blocker to prevent unwanted charge interactions between nucleic acids and other positively charged molecules. However, we have found that in some cases, the inclusion of dextran sulfate can interfere with antibody binding and recognition and we do not recommend using it with any of our TotalSeq™ reagents. It’s unclear what is the exact mechanism of action that causes this issue. All our protocols reflect this observation; thus we do not recommend the use of dextran sulfate.

Other Formats

View All Folate Receptor β Reagents Request Custom Conjugation

Pricing & Availability

Clone

100 (See other available formats)

Regulatory Status

RUO

Other Names

B-Cell CLL/Lymphoma 2 (Bcl-2), Protein Phosphatase 1, Regulatory Subunit 50

Isotype

Mouse IgG1

Ave. Rating

Submit a Review

Product Citations

publications

• 

Compare all formats See Alexa Fluor® 488 spectral data

Technical data sheet

Product Details

Reactivity

Human

Antibody Type

Monoclonal

Host Species

Mouse

Immunogen

Synthetic peptide of amino acids 41-54 of human bcl-2 oncoprotein

Formulation

Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 0.2% (w/v) BSA (origin USA).

Preparation

The antibody was purified by affinity chromatography and conjugated with Alexa Fluor® 488 under optimal conditions.

Concentration

Lot-specific (please contact technical support for concentration and total µg amount, or use our Lookup tool if you have a lot number.)

Storage & Handling

The antibody solution should be stored undiluted between 2°C and 8°C, and protected from prolonged exposure to light. Do not freeze.

Application

ICFC – Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by intracellular immunofluorescent staining with flow cytometric analysis. For flow cytometric staining, the suggested use of this reagent is 5 µl per million cells in 100 µl staining volume or 5 µl per 100 µl of whole blood.

* Alexa Fluor® 488 has a maximum emission of 519 nm when it is excited at 488 nm.

View full statement regarding label licenses

Excitation Laser

Blue Laser (488 nm)

Application References

(PubMed link indicates BioLegend citation)

1. Pezzella F, et al. 1993. New Eng. J. Med. 329:690. (IHC)
2. Pezzella F, et al. 1990. Am. J. Pathol. 137:225. (IHC)

Product Citations

1. Ramos CV, et al. 2020. Cell Reports. 32(3):107910. PubMed

RRID

AB_2563151 (BioLegend Cat. No. 658703)
AB_2563152 (BioLegend Cat. No. 658704)

Antigen Details

Structure

Distribution

Outer mitochondrial membrane, nuclear membrane, endoplasmic reticulum membrane.

Function

Regulates apoptosis through controlling mitochondrial fusion and fission.

Interaction

BAX, BAD, BAK, Bcl-X(L),EI24,APAF1, BBC3, BCL2L1, BNIPL, MRPL41, TP53BP2, FKBP8 BAG1, RAF1, EGLN3, G0S2, and BOP.

Cell Type

B cells

Biology Area

Apoptosis/Tumor Suppressors/Cell Death, Cell Biology, Cell Cycle/DNA Replication, Chromatin Remodeling/Epigenetics, Immunology, Mitochondrial Function, Neuroscience, Signal Transduction, Transcription Factors, Ubiquitin/Protein Degradation

Antigen References

1. Lin P, et al. 2013. Curr. Hematol. Malig. Rep. 8:243.
2. Tomita N. 2011. J. Clin. Exp. Hematop. 51:7.
3. Kelly PN, et al. 2011. Cell Death Differ. 18:1414.
4. Willimott S, et al. 2010. Biochem. Soc. Trans. 38:1571.
5. Rolland SG, et al. 2010. Curr. Opin. Cell Biol. 22:852.

Gene ID

596 View all products for this Gene ID

UniProt

View information about Bcl-2 on UniProt.org

Related Products

Related FAQs

There are no FAQs for this product.

Other Formats

View All Bcl-2 Reagents Request Custom Conjugation

Pricing & Availability

Clone

100 (See other available formats)

Regulatory Status

RUO

Other Names

B-Cell CLL/Lymphoma 2 (Bcl-2), Protein Phosphatase 1, Regulatory Subunit 50

Isotype

Mouse IgG1

Ave. Rating

Submit a Review

Product Citations

publications

• 

Compare all formats See Alexa Fluor® 647 spectral data

Technical data sheet

Product Details

Reactivity

Human

Antibody Type

Monoclonal

Host Species

Mouse

Immunogen

Synthetic peptide of amino acids 41-54 of human bcl-2 oncoprotein

Formulation

Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 0.2% (w/v) BSA (origin USA).

Preparation

The antibody was purified by affinity chromatography and conjugated with Alexa Fluor® 647 under optimal conditions.

Concentration

Lot-specific (please contact technical support for concentration and total µg amount, or use our Lookup tool if you have a lot number.)

Storage & Handling

The antibody solution should be stored undiluted between 2°C and 8°C, and protected from prolonged exposure to light. Do not freeze.

Application

ICFC – Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by intracellular immunofluorescent staining with flow cytometric analysis. For flow cytometric staining, the suggested use of this reagent is 5 µl per million cells in 100 µl staining volume or 5 µl per 100 µl of whole blood.

* Alexa Fluor® 647 has a maximum emission of 668 nm when it is excited at 633 nm / 635 nm.

View full statement regarding label licenses

Excitation Laser

Red Laser (633 nm)

Application References

(PubMed link indicates BioLegend citation)

1. Pezzella F, et al. 1993. New Eng. J. Med. 329:690. (IHC)
2. Pezzella F, et al. 1990. Am. J. Pathol. 137:225. (IHC)

Product Citations

1. Lin JR et al. 2018. eLife. 7 pii: e31657. PubMed
2. Herrera FG, et al. 2019. Int J Radiat Oncol Biol Phys. 103:320. PubMed
3. Lin J, Sorger M 2015. Sci Rep. 6: 8390. PubMed
4. Cai J, et al. 2021. eLife. 10:00. PubMed

RRID

AB_2563279 (BioLegend Cat. No. 658705)
AB_2563280 (BioLegend Cat. No. 658706)

Antigen Details

Structure

Distribution

Outer mitochondrial membrane, nuclear membrane, endoplasmic reticulum membrane.

Function

Regulates apoptosis through controlling mitochondrial fusion and fission.

Interaction

BAX, BAD, BAK, Bcl-X(L),EI24,APAF1, BBC3, BCL2L1, BNIPL, MRPL41, TP53BP2, FKBP8 BAG1, RAF1, EGLN3, G0S2, and BOP.

Cell Type

B cells

Biology Area

Apoptosis/Tumor Suppressors/Cell Death, Cell Biology, Cell Cycle/DNA Replication, Chromatin Remodeling/Epigenetics, Immunology, Mitochondrial Function, Neuroscience, Signal Transduction, Transcription Factors, Ubiquitin/Protein Degradation

Antigen References

1. Lin P, et al. 2013. Curr. Hematol. Malig. Rep. 8:243.
2. Tomita N. 2011. J. Clin. Exp. Hematop. 51:7.
3. Kelly PN, et al. 2011. Cell Death Differ. 18:1414.
4. Willimott S, et al. 2010. Biochem. Soc. Trans. 38:1571.
5. Rolland SG, et al. 2010. Curr. Opin. Cell Biol. 22:852.

Gene ID

596 View all products for this Gene ID

UniProt

View information about Bcl-2 on UniProt.org

Related Products

Related FAQs

There are no FAQs for this product.

Other Formats

View All Bcl-2 Reagents Request Custom Conjugation

Pricing & Availability

Clone

100 (See other available formats)

Regulatory Status

RUO

Other Names

B-Cell CLL/Lymphoma 2 (Bcl-2), Protein Phosphatase 1, Regulatory Subunit 50

Isotype

Mouse IgG1

Ave. Rating

Submit a Review

Product Citations

publications

• 

Compare all formats See Brilliant Violet 421™ spectral data

Technical data sheet

Product Details

Reactivity

Human

Antibody Type

Monoclonal

Host Species

Mouse

Immunogen

Synthetic peptide of amino acids 41-54 of human bcl-2 oncoprotein

Formulation

Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and BSA (origin USA).

Preparation

Concentration

Lot-specific (please contact technical support for concentration and total µg amount, or use our Lookup tool if you have a lot number.)

Storage & Handling

The antibody solution should be stored undiluted between 2°C and 8°C, and protected from prolonged exposure to light. Do not freeze.

Application

ICFC – Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by intracellular immunofluorescent staining with flow cytometric analysis. For flow cytometric staining, the suggested use of this reagent is 5 µl per million cells in 100 µl staining volume or 5 µl per 100 µl of whole blood.

.

This product is subject to proprietary rights of Sirigen Inc. and is made and sold under license from Sirigen Inc. The purchase of this product conveys to the buyer a non-transferable right to use the purchased product for research purposes only. This product may not be resold or incorporated in any manner into another product for resale. Any use for therapeutics or diagnostics is strictly prohibited. This product is covered by U.S. Patent(s), pending patent applications and foreign equivalents.

Excitation Laser

Violet Laser (405 nm)

Application References

(PubMed link indicates BioLegend citation)

1. Pezzella F, et al. 1993. New Eng. J. Med. 329:690. (IHC)
2. Pezzella F, et al. 1990. Am. J. Pathol. 137:225. (IHC)

RRID

AB_2563283 (BioLegend Cat. No. 658709)

Antigen Details

Structure

Two isoforms, 239 or 205 amino acids in length, with a predicted molecular weight of 26 kD or 22 kD and four ‘BH’ domains.

Distribution

Outer mitochondrial membrane, nuclear membrane, endoplasmic reticulum membrane.

Function

Regulates apoptosis through controlling mitochondrial fusion and fission.

Interaction

BAX, BAD, BAK, Bcl-X(L),EI24,APAF1, BBC3, BCL2L1, BNIPL, MRPL41, TP53BP2, FKBP8 BAG1, RAF1, EGLN3, G0S2, and BOP.

Cell Type

B cells

Biology Area

Apoptosis/Tumor Suppressors/Cell Death, Cell Biology, Cell Cycle/DNA Replication, Chromatin Remodeling/Epigenetics, Immunology, Mitochondrial Function, Neuroscience, Signal Transduction, Transcription Factors, Ubiquitin/Protein Degradation

Antigen References

1. Lin P, et al. 2013. Curr. Hematol. Malig. Rep. 8:243.
2. Tomita N. 2011. J. Clin. Exp. Hematop. 51:7.
3. Kelly PN, et al. 2011. Cell Death Differ. 18:1414.
4. Willimott S, et al. 2010. Biochem. Soc. Trans. 38:1571.
5. Rolland SG, et al. 2010. Curr. Opin. Cell Biol. 22:852.

Gene ID

596 View all products for this Gene ID

UniProt

View information about Bcl-2 on UniProt.org

Related Products

Related FAQs

What is the F/P ratio range of our BV421™ format antibody reagents?

It is lot-specific. On average it ranges between 2-4.

Other Formats

View All Bcl-2 Reagents Request Custom Conjugation

Pricing & Availability

Clone

100 (See other available formats)

Regulatory Status

RUO

Other Names

B-Cell CLL/Lymphoma 2 (Bcl-2), Protein Phosphatase 1, Regulatory Subunit 50

Isotype

Mouse IgG1

Ave. Rating

Submit a Review

Product Citations

publications

• 

Compare all formats See PE spectral data

Technical data sheet

Product Details

Reactivity

Human

Antibody Type

Monoclonal

Host Species

Mouse

Immunogen

Synthetic peptide of amino acids 41-54 of human bcl-2 oncoprotein

Formulation

Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 0.2% (w/v) BSA (origin USA).

Preparation

The antibody was purified by affinity chromatography and conjugated with PE under optimal conditions.

Concentration

Lot-specific (please contact technical support for concentration and total µg amount, or use our Lookup tool if you have a lot number.)

Storage & Handling

The antibody solution should be stored undiluted between 2°C and 8°C, and protected from prolonged exposure to light. Do not freeze.

Application

ICFC – Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by intracellular immunofluorescent staining with flow cytometric analysis. For flow cytometric staining, the suggested use of this reagent is 5 µl per million cells in 100 µl staining volume or 5 µl per 100 µl of whole blood.

Excitation Laser

Blue Laser (488 nm)
Green Laser (532 nm)/Yellow-Green Laser (561 nm)

Application References

(PubMed link indicates BioLegend citation)

1. Pezzella F, et al. 1993. New Eng. J. Med. 329:690. (IHC)
2. Pezzella F, et al. 1990. Am. J. Pathol. 137:225. (IHC)

Product Citations

1. Jeffery H, et al. 2017. Clin Exp Immunol. 10.1111/cei.12940. PubMed

RRID

AB_2563281 (BioLegend Cat. No. 658707)
AB_2563282 (BioLegend Cat. No. 658708)

Antigen Details

Structure

Distribution

Outer mitochondrial membrane, nuclear membrane, endoplasmic reticulum membrane.

Function

Regulates apoptosis through controlling mitochondrial fusion and fission.

Interaction

BAX, BAD, BAK, Bcl-X(L),EI24,APAF1, BBC3, BCL2L1, BNIPL, MRPL41, TP53BP2, FKBP8 BAG1, RAF1, EGLN3, G0S2, and BOP.

Cell Type

B cells

Biology Area

Apoptosis/Tumor Suppressors/Cell Death, Cell Biology, Cell Cycle/DNA Replication, Chromatin Remodeling/Epigenetics, Immunology, Mitochondrial Function, Neuroscience, Signal Transduction, Transcription Factors, Ubiquitin/Protein Degradation

Antigen References

1. Lin P, et al. 2013. Curr. Hematol. Malig. Rep. 8:243.
2. Tomita N. 2011. J. Clin. Exp. Hematop. 51:7.
3. Kelly PN, et al. 2011. Cell Death Differ. 18:1414.
4. Willimott S, et al. 2010. Biochem. Soc. Trans. 38:1571.
5. Rolland SG, et al. 2010. Curr. Opin. Cell Biol. 22:852.

Gene ID

596 View all products for this Gene ID

UniProt

View information about Bcl-2 on UniProt.org

Related Products

Related FAQs

What type of PE do you use in your conjugates?

We use R-PE in our conjugates.

Other Formats

View All Bcl-2 Reagents Request Custom Conjugation

Pricing & Availability

Clone

100 (See other available formats)

Regulatory Status

RUO

Other Names

B-Cell CLL/Lymphoma 2 (Bcl-2), Protein Phosphatase 1, Regulatory Subunit 50

Isotype

Mouse IgG1

Ave. Rating

Submit a Review

Product Citations

publications

• 

• 

Compare all formats

Technical data sheet

Product Details

Reactivity

Human

Antibody Type

Monoclonal

Host Species

Mouse

Immunogen

Synthetic peptide of amino acids 41-54 of human bcl-2 oncoprotein

Formulation

Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide.

Preparation

The antibody was purified by affinity chromatography.

Concentration

0.5 mg/mL

Storage & Handling

The antibody solution should be stored undiluted between 2°C and 8°C.

Application

WB – Quality tested
IHC-P – Verified
IHC-F – Reported in the literature, not verified in house

Recommended Usage

Each lot of this antibody is quality control tested by Western blotting. For Western blotting, the suggested use of this reagent is 0.5 – 2.0 µg per mL. For immunohistochemistry on formalin-fixed paraffin-embedded tissue sections, a concentration range of 5.0 µg/mL is suggested. It is recommended that the reagent be titrated for optimal performance for each application.

Application References

(PubMed link indicates BioLegend citation)

1. Pezzella F, et al. 1993. New Eng. J. Med. 329:690. (IHC)
2. Pezzella F, et al. 1990. Am. J. Pathol. 137:225. (IHC)

Product Citations

1. Zhou X, et al. 2019. Med Sci Monit. 25:836. PubMed
2. Wagner J et al. 2019. Cell. 177(5):1330-1345 . PubMed
3. Han L, et al. 2019. Haematologica. 10.3324/haematol.2018.205534. PubMed
4. Inao T, et al. 2019. Cancer Sci. 110:2690. PubMed
5. Eccles JD, et al. 2020. Cell Rep. 30:351. PubMed
6. Wu YH, et al. 2020. Mol Med Rep. 21:851. PubMed
7. Chong SJF, et al. 2020. Nucleic Acids Res. 48:12727. PubMed
8. Wang F, et al. 2020. Int J Oncol. 57:707. PubMed
9. Okimoto T, et al. 2020. Cancer Sci. 111:1910. PubMed

RRID

AB_2562958 (BioLegend Cat. No. 658701)
AB_2562959 (BioLegend Cat. No. 658702)

Antigen Details

Structure

Distribution

Outer mitochondrial membrane, nuclear membrane, endoplasmic reticulum membrane.

Function

Regulates apoptosis through controlling mitochondrial fusion and fission.

Interaction

BAX, BAD, BAK, Bcl-X(L),EI24,APAF1, BBC3, BCL2L1, BNIPL, MRPL41, TP53BP2, FKBP8 BAG1, RAF1, EGLN3, G0S2, and BOP.

Cell Type

B cells

Biology Area

Apoptosis/Tumor Suppressors/Cell Death, Cell Biology, Cell Cycle/DNA Replication, Chromatin Remodeling/Epigenetics, Immunology, Mitochondrial Function, Neuroscience, Signal Transduction, Transcription Factors, Ubiquitin/Protein Degradation

Antigen References

1. Lin P, et al. 2013. Curr. Hematol. Malig. Rep. 8:243.
2. Tomita N. 2011. J. Clin. Exp. Hematop. 51:7.
3. Kelly PN, et al. 2011. Cell Death Differ. 18:1414.
4. Willimott S, et al. 2010. Biochem. Soc. Trans. 38:1571.
5. Rolland SG, et al. 2010. Curr. Opin. Cell Biol. 22:852.

Gene ID

596 View all products for this Gene ID

UniProt

View information about Bcl-2 on UniProt.org

Related Products

Related FAQs

There are no FAQs for this product.

Other Formats

View All Bcl-2 Reagents Request Custom Conjugation

Pricing & Availability

Clone

104 (See other available formats)

Regulatory Status

RUO

Other Names

Ly-5.2, LCA

Isotype

Mouse (SJL) IgG2a, κ

Ave. Rating

Submit a Review

Product Citations

publications

• 

Compare all formats See Alexa Fluor® 488 spectral data

Technical data sheet

Product Details

Reactivity

Mouse

Antibody Type

Monoclonal

Host Species

Mouse

Immunogen

B10.S mouse thymocytes and splenocytes

Formulation

Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide.

Preparation

The antibody was purified by affinity chromatography and conjugated with Alexa Fluor® 488 under optimal conditions.

Concentration

0.5 mg/ml

Storage & Handling

The antibody solution should be stored undiluted between 2°C and 8°C, and protected from prolonged exposure to light. Do not freeze.

Application

FC – Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis⁶ cells in 100 µl volume. It is recommended that the reagent be titrated for optimal performance for each application.

* Alexa Fluor® 488 has a maximum emission of 519 nm when it is excited at 488 nm.

View full statement regarding label licenses

Excitation Laser

Blue Laser (488 nm)

Application Notes

The 104 antibody does not react with mouse cells expressing the CD45.1 alloantigen. Additional reported applications (for the relevant formats) include: immunoprecipitation⁴, in vivo and in vitro blocking of B cell responses^1,2, and immunohistochemical staining of acetone-fixed frozen sections³. 

Application References

(PubMed link indicates BioLegend citation)

1. Yakura H, et al. 1983. J. Exp. Med. 157:1077. (Block)
2. Yakura H, et al. 1986. J. Immunol. 136:2729. (Block)
3. Suzuki K, et al. 2000. Immunity 13:691. (IHC)
4. Shen FW, et al. 1986. Immunogenetics 24:146. (IP)
5. Baldwin TA and Hogquist KA. 2007. J. Immunol. 179:837.
6. Pascal V, et al. 2007. J. Immunol. 179:1751.
7. Burman AC, et al. 2007. Blood 110:1064.
8. Kincaid EZ, et al. 2007. J. Immunol. 179:3187.
9. Phan TG, et al. 2007. Nature Immunol. 8:992.
10. Nakano-Yokomizo T, et al. 2011. J. Exp Med. 208:1661. PubMed
11. Wen T, et al. 2013. PNAS. 110:6067. PubMed
12. Kohlmeier JE, et al. 2008. Immunity. 29:101. (FC) PubMed

Product Citations

1. Jing Li et al. 2018. Immunity. 48(4):773-786 . PubMed
2. Peterson EJ, et al. 2019. Mol Syst Biol. 15:e8584. PubMed
3. Sinclair LV et al. 2019. Elife. 8 pii: e44210. PubMed
4. Baptista AP et al. 2019. Immunity. 50(5):1188-1201 . PubMed
5. Lever JM, et al. 2019. JCI Insight. 4:e125503. PubMed
6. Zhang F, et al. 2019. Front Immunol. 2.077777778. PubMed
7. Wang L, et al. 2020. Cells. 0.458333333. PubMed
8. Marchingo JM, et al. 2020. eLife. 9:e53725.. PubMed
9. Wen T, et al. 2013. Proc Natl Acad Sci U S A. 110:6067. PubMed
10. Hirasawa M, et al. 2016. J Biol Chem. 291: 7373-7385. PubMed
11. Jonas B, et al. 2016. PLoS One. 11: 0159189. PubMed
12. Wang X, et al. 2021. EMBO J. 40:e105926. PubMed
13. Akkaya M, et al. 2020. Sci Rep. 10:13630. PubMed
14. Hirai T, et al. 2020. Immunity. 54(1):84-98.e5. PubMed
15. Delacher M, et al. 2021. Immunity. 54(4):702-720.e17. PubMed
16. Inverso D, et al. 2021. Developmental Cell. 56(11):1677-1693.e10. PubMed

RRID

AB_492869 (BioLegend Cat. No. 109815)
AB_492868 (BioLegend Cat. No. 109816)

Antigen Details

Structure

Protein tyrosine phosphatase (PTP) family, 180-240 kD

Distribution

All hematopoietic cells except mature erythrocytes and platelets of the CD45.2 strain of mice

Function

Phosphatase, T and B cell activation

Ligand/Receptor

Galectin-1, CD2, CD3, CD4

Biology Area

Cell Biology, Immunology, Inhibitory Molecules, Innate Immunity, Neuroscience, Neuroscience Cell Markers

Molecular Family

CD Molecules

Antigen References

1. Suzuki K, et al. 2000. Immunity 13:691.

Gene ID

19264 View all products for this Gene ID

UniProt

View information about CD45.2 on UniProt.org

Related Products

Related FAQs

There are no FAQs for this product.

Other Formats

View All CD45.2 Reagents Request Custom Conjugation

Pricing & Availability

Clone

104 (See other available formats)

Regulatory Status

RUO

Other Names

Ly-5.2, LCA

Isotype

Mouse (SJL) IgG2a, κ

Ave. Rating

Submit a Review

Product Citations

publications

• 

Compare all formats See Alexa Fluor® 594 spectral data

Technical data sheet

Product Details

Reactivity

Mouse

Antibody Type

Monoclonal

Host Species

Mouse

Immunogen

B10.S mouse thymocytes and splenocytes

Formulation

Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide.

Preparation

The antibody was purified by affinity chromatography and conjugated with Alexa Fluor® 594 under optimal conditions.

Concentration

0.5 mg/ml

Storage & Handling

The antibody solution should be stored undiluted between 2°C and 8°C, and protected from prolonged exposure to light. Do not freeze.

Application

IHC-F – Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunohistochemical staining on frozen tissue sections. For immunohistochemistry, a concentration range of 5.0 – 10 μg/ml is suggested. It is recommended that the reagent be titrated for optimal performance for each application.

* Alexa Fluor® 594 has an excitation maximum of 590 nm, and a maximum emission of 617 nm.

View full statement regarding label licenses

Application Notes

The 104 antibody does not react with mouse cells expressing the CD45.1 alloantigen. Additional reported applications (for the relevant formats) include: immunoprecipitation⁴, in vivo and in vitro blocking of B cell responses^1,2, and immunohistochemical staining of acetone-fixed frozen sections³. 

Application References

(PubMed link indicates BioLegend citation)

1. Yakura H, et al. 1983. J. Exp. Med. 157:1077. (Block)
2. Yakura H, et al. 1986. J. Immunol. 136:2729. (Block)
3. Suzuki K, et al. 2000. Immunity 13:691. (IHC)
4. Shen FW, et al. 1986. Immunogenetics 24:146. (IP)
5. Baldwin TA and Hogquist KA. 2007. J. Immunol. 179:837.
6. Pascal V, et al. 2007. J. Immunol. 179:1751.
7. Burman AC, et al. 2007. Blood 110:1064.
8. Kincaid EZ, et al. 2007. J. Immunol. 179:3187.
9. Phan TG, et al. 2007. Nature Immunol. 8:992.
10. Nakano-Yokomizo T, et al. 2011. J. Exp Med. 208:1661. PubMed
11. Wen T, et al. 2013. PNAS. 110:6067. PubMed
12. Kohlmeier JE, et al. 2008. Immunity. 29:101. (FC) PubMed

RRID

AB_2629589 (BioLegend Cat. No. 109850)

Antigen Details

Structure

Protein tyrosine phosphatase (PTP) family, 180-240 kD

Distribution

All hematopoietic cells except mature erythrocytes and platelets of the CD45.2 strain of mice

Function

Phosphatase, T and B cell activation

Ligand/Receptor

Galectin-1, CD2, CD3, CD4

Biology Area

Cell Biology, Immunology, Inhibitory Molecules, Innate Immunity, Neuroscience, Neuroscience Cell Markers

Molecular Family

CD Molecules

Antigen References

1. Suzuki K, et al. 2000. Immunity 13:691.

Gene ID

19264 View all products for this Gene ID

UniProt

View information about CD45.2 on UniProt.org

Related Products

Related FAQs

There are no FAQs for this product.

Other Formats

View All CD45.2 Reagents Request Custom Conjugation

Pricing & Availability

Clone

104 (See other available formats)

Regulatory Status

RUO

Other Names

Ly-5.2, LCA

Isotype

Mouse (SJL) IgG2a, κ

Ave. Rating

Submit a Review

Product Citations

publications

• 

Compare all formats See Alexa Fluor® 647 spectral data

Technical data sheet

Product Details

Reactivity

Mouse

Antibody Type

Monoclonal

Host Species

Mouse

Immunogen

B10.S mouse thymocytes and splenocytes

Formulation

Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide.

Preparation

The antibody was purified by affinity chromatography and conjugated with Alexa Fluor® 647 under optimal conditions.

Concentration

0.5 mg/ml

Storage & Handling

The antibody solution should be stored undiluted between 2°C and 8°C, and protected from prolonged exposure to light. Do not freeze.

Application

FC – Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis

* Alexa Fluor® 647 has a maximum emission of 668 nm when it is excited at 633 nm / 635 nm.

View full statement regarding label licenses

Excitation Laser

Red Laser (633 nm)

Application Notes

The 104 antibody does not react with mouse cells expressing the CD45.1 alloantigen. Additional reported applications (for the relevant formats) include: immunoprecipitation⁴, in vivo and in vitro blocking of B cell responses^1,2, and immunohistochemical staining of acetone-fixed frozen sections³. 

Application References

(PubMed link indicates BioLegend citation)

1. Yakura H, et al. 1983. J. Exp. Med. 157:1077. (Block)
2. Yakura H, et al. 1986. J. Immunol. 136:2729. (Block)
3. Suzuki K, et al. 2000. Immunity 13:691. (IHC)
4. Shen FW, et al. 1986. Immunogenetics 24:146. (IP)
5. Baldwin TA and Hogquist KA. 2007. J. Immunol. 179:837.
6. Pascal V, et al. 2007. J. Immunol. 179:1751.
7. Burman AC, et al. 2007. Blood 110:1064.
8. Kincaid EZ, et al. 2007. J. Immunol. 179:3187.
9. Phan TG, et al. 2007. Nature Immunol. 8:992.
10. Nakano-Yokomizo T, et al. 2011. J. Exp Med. 208:1661. PubMed
11. Wen T, et al. 2013. PNAS. 110:6067. PubMed
12. Kohlmeier JE, et al. 2008. Immunity. 29:101. (FC) PubMed

Product Citations

1. Hamilton J,et al. 2017. J Immunol. 10.4049/jimmunol.1700888. PubMed
2. Emgård J, et al. 2018. Immunity. 143:419. PubMed
3. Chojnacki A, et al. 2019. Commun Biol. 2:181. PubMed
4. Kelsey E Sivick et al. 2018. Cell reports. 25(11):3074-3085 . PubMed
5. Dalmas E et al. 2017. Immunity. 47(5):928-942 . PubMed
6. Baptista AP et al. 2019. Immunity. 50(5):1188-1201 . PubMed
7. Ghezraoui H, et al. 2018. Nature. 560:122. PubMed
8. Béguelin W, et al. 2020. Cancer Cell. 37(5):655-673. PubMed
9. Roufaiel M, et al. 2016. Nat Immunol. 10.1038/ni.3564. PubMed
10. Mller K, et al. 2021. EMBO Molecular Medicine. 13(4):e13390. PubMed
11. Perner C, et al. 2020. Immunity. 53(5):1063-1077.e7. PubMed
12. Ringel AE, et al. 2020. Cell. 183(7):1848-1866.e26. PubMed
13. Delacher M, et al. 2021. Immunity. 54(4):702-720.e17. PubMed
14. Seydoux E, et al. 2021. Cell Reports. 35(5):109084. PubMed
15. Wong HS, et al. 2021. Cell. . PubMed

RRID

AB_492871 (BioLegend Cat. No. 109817)
AB_492870 (BioLegend Cat. No. 109818)

Antigen Details

Structure

Protein tyrosine phosphatase (PTP) family, 180-240 kD

Distribution

All hematopoietic cells except mature erythrocytes and platelets of the CD45.2 strain of mice

Function

Phosphatase, T and B cell activation

Ligand/Receptor

Galectin-1, CD2, CD3, CD4

Biology Area

Cell Biology, Immunology, Inhibitory Molecules, Innate Immunity, Neuroscience, Neuroscience Cell Markers

Molecular Family

CD Molecules

Antigen References

1. Suzuki K, et al. 2000. Immunity 13:691.

Gene ID

19264 View all products for this Gene ID

UniProt

View information about CD45.2 on UniProt.org

Related Products

Related FAQs

There are no FAQs for this product.

Other Formats

View All CD45.2 Reagents Request Custom Conjugation

Pricing & Availability

Clone

104 (See other available formats)

Regulatory Status

RUO

Other Names

Ly-5.2, LCA

Isotype

Mouse (SJL) IgG2a, κ

Ave. Rating

Submit a Review

Product Citations

publications

• 

Compare all formats See Alexa Fluor® 700 spectral data

Technical data sheet

Product Details

Reactivity

Mouse

Antibody Type

Monoclonal

Host Species

Mouse

Immunogen

B10.S mouse thymocytes and splenocytes

Formulation

Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide.

Preparation

The antibody was purified by affinity chromatography and conjugated with Alexa Fluor® 700 under optimal conditions.

Concentration

0.5 mg/ml

Storage & Handling

The antibody solution should be stored undiluted between 2°C and 8°C, and protected from prolonged exposure to light. Do not freeze.

Application

FC – Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis

* Alexa Fluor® 700 has a maximum emission of 719 nm when it is excited at 633 nm / 635 nm. Prior to using Alexa Fluor® 700 conjugate for flow cytometric analysis, please verify your flow cytometer’s capability of exciting and detecting the fluorochrome.

View full statement regarding label licenses

Excitation Laser

Red Laser (633 nm)

Application Notes

The 104 antibody does not react with mouse cells expressing the CD45.1 alloantigen. Additional reported applications (for the relevant formats) include: immunoprecipitation⁴, in vivo and in vitro blocking of B cell responses^1,2, and immunohistochemical staining of acetone-fixed frozen sections³. 

Application References

(PubMed link indicates BioLegend citation)

1. Yakura H, et al. 1983. J. Exp. Med. 157:1077. (Block)
2. Yakura H, et al. 1986. J. Immunol. 136:2729. (Block)
3. Suzuki K, et al. 2000. Immunity 13:691. (IHC)
4. Shen FW, et al. 1986. Immunogenetics 24:146. (IP)
5. Baldwin TA and Hogquist KA. 2007. J. Immunol. 179:837.
6. Pascal V, et al. 2007. J. Immunol. 179:1751.
7. Burman AC, et al. 2007. Blood 110:1064.
8. Kincaid EZ, et al. 2007. J. Immunol. 179:3187.
9. Phan TG, et al. 2007. Nature Immunol. 8:992.
10. Nakano-Yokomizo T, et al. 2011. J. Exp Med. 208:1661. PubMed
11. Wen T, et al. 2013. PNAS. 110:6067. PubMed
12. Kohlmeier JE, et al. 2008. Immunity. 29:101. (FC) PubMed

Product Citations

1. Zaid A,et al. 2017. J Immunol. 10.4049/jimmunol.1700571. PubMed
2. Böttcher JP, et al. 2018. Cell. 172:1022. PubMed
3. Aurélien Trompette et al. 2018. Immunity. 48(5):992-1005 . PubMed
4. Turner JS et al. 2018. Cell reports. 25(6):1395-1403 . PubMed
5. Kleppe M et al. 2018. Cancer cell. 33(1):29-43 . PubMed
6. Vasamsetti SB, et al. 2018. Immunity. 49:93. PubMed
7. Booth CAG, et al. 2018. Cancer Cell. 33:274. PubMed
8. Adams NM et al. 2018. Immunity. 48(6):1172-1182 . PubMed
9. Geary CD et al. 2018. Cell reports. 24(8):1949-1957 . PubMed
10. Cohen SB et al. 2018. Cell host & microbe. 24(3):439-446 . PubMed
11. Bradley CP et al. 2017. Cell host & microbe. 22(5):697-704 . PubMed
12. Hayatsu N et al. 2017. Immunity. 47(2):268-283 . PubMed
13. Wu J et al. 2017. Immunity. 47(6):1114-1128 . PubMed
14. Goldstein JM et al. 2019. Cell reports. 27(4):1254-1264 . PubMed
15. Kubli SP, et al. 2019. Nat Commun. 10:2678. PubMed
16. Contreras NA, et al. 2019. PLoS Pathog. 15:e1007890. PubMed
17. Page N, et al. 2018. Immunity. 48:937. PubMed
18. Louveau A, et al. 2018. Nat Neurosci. 21:1380. PubMed
19. He W et al. 2018. Immunity. 49(6):1175-1190 . PubMed
20. Kim TJ, et al. 2019. Nat Commun. 10:3258. PubMed
21. Koyama M et al. 2019. Immunity. 51(5):885-898 . PubMed
22. Sparber F, et al. 2019. Cell Host Microbe. 25:389. PubMed
23. Baptista AP et al. 2019. Immunity. 50(5):1188-1201 . PubMed
24. Nabet BY et al. 2017. Cell. 170(2):352-366 . PubMed
25. Ersching J et al. 2017. Immunity. 46(6):1045-1058 . PubMed
26. Benci JL et al. 2016. Cell. 167(6):1540-1554 . PubMed
27. Lagares D, et al. 2017. Sci Transl Med. 9:eaal3765. PubMed
28. Urata S, et al. 2018. PLoS Pathog. 14:e1007172. PubMed
29. Denny JE, et al. 2019. Sci Rep. 2.786111111. PubMed
30. Di Genua C, et al. 2019. Haematologica. 104:2215. PubMed
31. Patel S, et al. 2019. Viruses. 0.877083333. PubMed
32. Zhang H, et al. 2019. Mol Cell. 76:110. PubMed
33. Ciecko AE, et al. 2019. Cell Rep. 29:3073. PubMed
34. Mesin L, et al. 2020. Cell. 180(1):92-106.e11.. PubMed
35. Hidalgo San Jose L, et al. 2020. Cell Rep. 30:69. PubMed
36. Fallet B, et al. 2020. Cell Rep. 30:1013. PubMed
37. Horkova V, et al. 2020. Cell Reports. 30(5):1504-1514.e7.. PubMed
38. Yoshimi A, et al. 2019. Nature. 574:273. PubMed
39. Di Genua C, et al. 2020. Cancer Cell. 37(5):690-704.e8.. PubMed
40. Frodermann V, et al. 2019. Nat Med. 25:1761. PubMed
41. Chandran S, et al. 2020. Front Immunol. 11:787. PubMed
42. Kawabe T, et al. 2020. Nat Commun. 2.795833333. PubMed
43. Lebel MÈ, et al. 2020. Nat Commun. 3.051388889. PubMed
44. Loo CS, et al. 2020. Immunity. 53:143. PubMed
45. Leruste A, et al. 2020. Cancer Cell. 36(6):597-612.e8.. PubMed
46. Viny AD, et al. 2019. Cell Stem Cell. 25:682. PubMed
47. He J, et al. 2020. Cell Reports. 29(9):2718-2730.e6.. PubMed
48. Zenke S, et al. 2020. Immunity. 52(2):313-327. PubMed
49. Wang Y, et al. 2020. eLife. 9:e57438.. PubMed
50. Diaz–Salazar C, et al. 2020. Cell Rep. 32:108186. PubMed
51. Kang S, et al. 2011. J Exp Med. 208:747. PubMed
52. Semmrich M, et al. 2011. Mucosal Immunol. 0.3125. PubMed
53. Zinselmeyer B, et al. 2013. J Exp Med. 210:757. PubMed
54. Basu S, et al. 2013. J Immunol Methods. 396:163. PubMed
55. Markey K, et al. 2014. J Immunol. 192:5426. PubMed
56. DeFranco D 2014. Proc Natl Acad Sci U S A. 111:3224. PubMed
57. Nadrah K, et al. 2015. PLoS One. 10: 0136061. PubMed
58. Kretschmer B, et al. 2015. Immunobiology. 220: 964-975. PubMed
59. Luck H, et al. 2015. Cell Metab. 21 527 . PubMed
60. XS R, et al. 2015. Diabetes. 64 90. PubMed
61. Amos J, et al. 2015. J Virol. 89: 9485-9498. PubMed
62. X X, et al. 2016. J Immunol . 197: 1683-1691. PubMed
63. Kurowska-Stolarska M, et al. 2016. J Allergy Clin Immunol. S0091-6749(16)31132-0. PubMed
64. Sebina I, et al. 2016. PLoS Pathog. 12:e1005999. PubMed
65. Panciera T, et al. 2016. Cell Stem Cell. 19:725-737. PubMed
66. Rao S, et al. 2017. Cell. 168(3):503-516.e12. PubMed
67. Wiedemann GM, et al. 2020. Cell Rep. 33:108498. PubMed
68. Amor C, et al. 2020. Nature. 583:127. PubMed
69. Hildreth AD, et al. 2020. STAR Protoc. 1:100113. PubMed
70. Schilke RM, et al. 2020. Immunohorizons. 0.624305556. PubMed
71. Iwanami N, et al. 2020. iScience. 23:101260. PubMed
72. Li Y, et al. 2020. Cell Stem Cell. 27(5):732-747.e7. PubMed
73. Plumlee CR, et al. 2020. Cell Host Microbe. 29(1):68-82.e5. PubMed
74. Guendel F, et al. 2020. Immunity. 53(5):1015-1032.e8. PubMed
75. Rustenhoven J, et al. 2021. Cell. 184(4):1000-1016.e27. PubMed
76. Chakraborty M, et al. 2021. Cell Reports. 34(2):108609. PubMed
77. Heyde A, et al. 2021. Cell. 184(5):1348-1361.e22. PubMed
78. Chen R, et al. 2021. Cell Reports. 34(7):108751. PubMed
79. Loo Yau H, et al. 2021. Molecular Cell. 81(7):1469-1483.e8. PubMed
80. Gern BH, et al. 2021. Cell Host Microbe. 29(4):594-606.e6. PubMed
81. He Y, et al. 2021. Cell Metabolism. 33(5):988-1000.e7. PubMed
82. Sheppard S, et al. 2021. Cell Reports. 35(9):109210. PubMed

RRID

AB_493730 (BioLegend Cat. No. 109821)
AB_493731 (BioLegend Cat. No. 109822)

Antigen Details

Structure

Protein tyrosine phosphatase (PTP) family, 180-240 kD

Distribution

All hematopoietic cells except mature erythrocytes and platelets of the CD45.2 strain of mice

Function

Phosphatase, T and B cell activation

Ligand/Receptor

Galectin-1, CD2, CD3, CD4

Biology Area

Cell Biology, Immunology, Inhibitory Molecules, Innate Immunity, Neuroscience, Neuroscience Cell Markers

Molecular Family

CD Molecules

Antigen References

1. Suzuki K, et al. 2000. Immunity 13:691.

Gene ID

19264 View all products for this Gene ID

UniProt

View information about CD45.2 on UniProt.org

Related Products

Related FAQs

There are no FAQs for this product.

Other Formats

View All CD45.2 Reagents Request Custom Conjugation

Pricing & Availability

Clone

104 (See other available formats)

Regulatory Status

RUO

Other Names

Ly-5.2, LCA

Isotype

Mouse (SJL) IgG2a, κ

Ave. Rating

Submit a Review

Product Citations

publications

• 

Compare all formats See APC spectral data

Technical data sheet

Product Details

Reactivity

Mouse

Antibody Type

Monoclonal

Host Species

Mouse

Immunogen

B10.S mouse thymocytes and splenocytes

Formulation

Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide.

Preparation

The antibody was purified by affinity chromatography, and conjugated with APC under optimal conditions.

Concentration

0.2 mg/ml

Storage & Handling

The CD45.2 antibody solution should be stored undiluted between 2°C and 8°C, and protected from prolonged exposure to light. Do not freeze.

Application

FC – Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis⁶ cells in 100 µl volume. It is recommended that the reagent be titrated for optimal performance for each application.

Excitation Laser

Red Laser (633 nm)

Application Notes

The 104 antibody does not react with mouse cells expressing the CD45.1 alloantigen. Additional reported applications (for the relevant formats) include: immunoprecipitation⁴, in vivo and in vitro blocking of B cell responses^1,2, and immunohistochemical staining of acetone-fixed frozen sections³. 

Application References

(PubMed link indicates BioLegend citation)

1. Yakura H, et al. 1983. J. Exp. Med. 157:1077. (Block)
2. Yakura H, et al. 1986. J. Immunol. 136:2729. (Block)
3. Suzuki K, et al. 2000. Immunity 13:691. (IHC)
4. Shen FW, et al. 1986. Immunogenetics 24:146. (IP)
5. Baldwin TA and Hogquist KA. 2007. J. Immunol. 179:837.
6. Pascal V, et al. 2007. J. Immunol. 179:1751.
7. Burman AC, et al. 2007. Blood 110:1064.
8. Kincaid EZ, et al. 2007. J. Immunol. 179:3187.
9. Phan TG, et al. 2007. Nature Immunol. 8:992.
10. Nakano-Yokomizo T, et al. 2011. J. Exp Med. 208:1661. PubMed
11. Wen T, et al. 2013. PNAS. 110:6067. PubMed
12. Kohlmeier JE, et al. 2008. Immunity. 29:101. (FC) PubMed

Product Citations

1. Degn SE et al. 2017. Cell. 170(5):913-926 . PubMed
2. Palazon A, et al. 2017. Cancer Cell. . 10.1016/j.ccell.2017.10.003. PubMed
3. Asada S, et al. 2018. Nat Commun. 9:2733. PubMed
4. Hirota K et al. 2018. Immunity. 48(6):1220-1232 . PubMed
5. Bowers E, et al. 2018. Nat Med. 24:95. PubMed
6. Xu X, et al. 2018. Cell. 175:1336. PubMed
7. Burrack KS et al. 2018. Immunity. 48(4):760-772 . PubMed
8. Kleppe M et al. 2018. Cancer cell. 33(1):29-43 . PubMed
9. Habtetsion T et al. 2018. Cell metabolism. 28(2):228-242 . PubMed
10. Lu Y, et al. 2018. Cancer Cell. 33:1048. PubMed
11. Cohen SB et al. 2018. Cell host & microbe. 24(3):439-446 . PubMed
12. Firl DJ et al. 2018. eLife. 7 pii: e33051. PubMed
13. Luo H, et al. 2019. Cell Rep. 26:945. PubMed
14. Chen S, et al. 2018. Nat Commun. 9:5298. PubMed
15. Hayatsu N et al. 2017. Immunity. 47(2):268-283 . PubMed
16. Goldstein JM et al. 2019. Cell reports. 27(4):1254-1264 . PubMed
17. Timilshina M, et al. 2020. Cell Reports. 27(10):2948-2961.e7.. PubMed
18. Maroni G, et al. 2019. Int J Mol Sci. 20. PubMed
19. Uchimura T et al. 2018. Immunity. 49(6):1049-1061 . PubMed
20. Hou X, et al. 2020. Cell Reports. 28(1):172-189.e7.. PubMed
21. Radulovic V, et al. 2020. Cell Reports. 27(10):2826-2836.e5.. PubMed
22. Jayachandran R, et al. 2019. Immunity. 50:152. PubMed
23. Kaplan BLF et al. 2018. Current protocols in toxicology. 75:11:00 25. PubMed
24. Yuan X, et al. 2017. Elife. 6:e29540. PubMed
25. Lechner AJ et al. 2017. Cell stem cell. 21(1):120-134 . PubMed
26. Woodworth JS, et al. 2017. Mucosal Immunol. 0.802083333. PubMed
27. van der Poel CE, et al. 2019. Cell Rep. 29:2745. PubMed
28. Tsuchiya N, et al. 2020. Cell Reports. 29(1):162-175.e9.. PubMed
29. Schadt L, et al. 2020. Cell Reports. 29(5):1236-1248.e7.. PubMed
30. Zhou L, et al. 2020. Clin Cancer Res. 26:290. PubMed
31. Han CY, et al. 2020. Cell Reports. 31(13):107818. PubMed
32. Krummey SM, et al. 2020. Cell Reports. 30(5):1282-1291.e5.. PubMed
33. Pfirschke C, et al. 2020. Cell Rep. 32:108164. PubMed
34. Garaycoechea JI, et al. 2018. Nature. 553:171. PubMed
35. Takizawa H, et al. 2011. J Exp Med. 208:273. PubMed
36. Markey K, et al. 2012. Blood. 119:5918. PubMed
37. Santamaria-Martínez A, et al. 2009. Exp Cell Res. 315:3004. PubMed
38. Markey K, et al. 2014. J Immunol. 192:5426. PubMed
39. Brocq M, et al. 2014. J Immunol. 192:6120. PubMed
40. Guo H, et al. 2014. J Leukoc Biol. 96:419. PubMed
41. Schaefer K, et al. 2014. PLoS One. 9:114824. PubMed
42. Zhang J, et al. 2015. PLoS One. 10:130441. PubMed
43. Koyama M, et al. 2015. J Exp Med. 212: 1303 – 1321. PubMed
44. Gordon E, et al. 2015. Proc Natl Acad Sci U S A. 112: 13075 – 13080. PubMed
45. Guo Z, et al. 2016. Nat Commun. 7:10307. PubMed
46. Kondo M, et al. 2016. J Immunol. 196: 563 – 572. PubMed
47. Jutz S, et al. 2016. J Immunol Methods. 430:10-20. PubMed
48. Guo H, Cooper S, Friedman A, et al. 2017. PLoS One. 10.1371/journal.pone.0150809. PubMed
49. Kalinski AL, et al. 2020. Elife. 9:00. PubMed
50. Kobia FM, et al. 2020. PLoS Biol. 18:e3000850. PubMed
51. Fuster JJ, et al. 2020. Cell Rep. 33:108326. PubMed
52. Boyd DF, et al. 2020. Nature. 587:466. PubMed
53. Ferrari de Andrade L, et al. 2020. Cancer Immunol Res. 0.867361111. PubMed
54. Melo-Silva CR, et al. 2021. PLOS Pathogens. 17(5):e1009593. PubMed
55. Winkler ES, et al. 2020. Cell. 182(4):901-918.e18. PubMed
56. Dufva O, et al. 2020. Cancer Cell. 38(3):380-399.e13. PubMed
57. Borges da Silva H, et al. 2020. Immunity. 53(1):158-171.e6. PubMed
58. Hirai T, et al. 2020. Immunity. 54(1):84-98.e5. PubMed
59. Ringel AE, et al. 2020. Cell. 183(7):1848-1866.e26. PubMed
60. Xu W, et al. 2021. Immunity. 54(3):526-541.e7. PubMed
61. Heyde A, et al. 2021. Cell. 184(5):1348-1361.e22. PubMed
62. Deerhake ME, et al. 2021. Immunity. 54(3):484-498.e8. PubMed
63. Gern BH, et al. 2021. Cell Host Microbe. 29(4):594-606.e6. PubMed
64. Levine LS, et al. 2021. Immunity. 54(4):829-844.e5. PubMed
65. Mitchell JE, et al. 2021. Cell Reports. 35(2):108966. PubMed
66. Mandal RK, et al. 2021. Cell Reports. 35(6):109094. PubMed
67. Qin Q, et al. 2021. Cell Reports. 35(8):109161. PubMed
68. Lu SX, et al. 2021. Cell. . PubMed
69. Marangoni F, et al. 2021. Cell. . PubMed

RRID

AB_389210 (BioLegend Cat. No. 109813)
AB_389211 (BioLegend Cat. No. 109814)

Antigen Details

Structure

Protein tyrosine phosphatase (PTP) family, 180-240 kD

Distribution

All hematopoietic cells except mature erythrocytes and platelets of the CD45.2 strain of mice

Function

Phosphatase, T and B cell activation

Ligand/Receptor

Galectin-1, CD2, CD3, CD4

Biology Area

Cell Biology, Immunology, Inhibitory Molecules, Innate Immunity, Neuroscience, Neuroscience Cell Markers

Molecular Family

CD Molecules

Antigen References

1. Suzuki K, et al. 2000. Immunity 13:691.

Gene ID

19264 View all products for this Gene ID

UniProt

View information about CD45.2 on UniProt.org

Related Products

Related FAQs

There are no FAQs for this product.

Other Formats

View All CD45.2 Reagents Request Custom Conjugation

Pricing & Availability

Clone

104 (See other available formats)

Regulatory Status

RUO

Other Names

Ly-5.2, LCA

Isotype

Mouse (SJL) IgG2a, κ

Ave. Rating

Submit a Review

Product Citations

publications

• 

Compare all formats See APC/Cyanine7 spectral data

Technical data sheet

Product Details

Reactivity

Mouse

Antibody Type

Monoclonal

Host Species

Mouse

Immunogen

B10.S mouse thymocytes and splenocytes

Formulation

Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide.

Preparation

The antibody was purified by affinity chromatography, and conjugated with APC/Cyanine7 under optimal conditions.

Concentration

0.2 mg/ml

Storage & Handling

The antibody solution should be stored undiluted between 2°C and 8°C, and protected from prolonged exposure to light. Do not freeze.

Application

FC – Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis. For flow cytometric staining, the suggested use of this reagent is =1.0 µg per million cells in 100 µl volume. It is recommended that the reagent be titrated for optimal performance for each application.

Excitation Laser

Red Laser (633 nm)

Application Notes

The 104 antibody does not react with mouse cells expressing the CD45.1 alloantigen. Additional reported applications (for the relevant formats) include: immunoprecipitation⁴, in vivo and in vitro blocking of B cell responses^1,2, and immunohistochemical staining of acetone-fixed frozen sections³. 

Additional Product Notes

BioLegend is in the process of converting the name APC/Cy7 to APC/Cyanine7. The dye molecule remains the same, so you should expect the same quality and performance from our APC/Cyanine7 products. Please contact if you have any questions.

Application References

(PubMed link indicates BioLegend citation)

1. Yakura H, et al. 1983. J. Exp. Med. 157:1077. (Block)
2. Yakura H, et al. 1986. J. Immunol. 136:2729. (Block)
3. Suzuki K, et al. 2000. Immunity 13:691. (IHC)
4. Shen FW, et al. 1986. Immunogenetics 24:146. (IP)
5. Baldwin TA and Hogquist KA. 2007. J. Immunol. 179:837.
6. Pascal V, et al. 2007. J. Immunol. 179:1751.
7. Burman AC, et al. 2007. Blood 110:1064.
8. Kincaid EZ, et al. 2007. J. Immunol. 179:3187.
9. Phan TG, et al. 2007. Nature Immunol. 8:992.
10. Nakano-Yokomizo T, et al. 2011. J. Exp Med. 208:1661. PubMed
11. Wen T, et al. 2013. PNAS. 110:6067. PubMed
12. Kohlmeier JE, et al. 2008. Immunity. 29:101. (FC) PubMed

Product Citations

1. Ma W, et al. 2017. Cell Death & Disease. 10.1038/cddis.2017.47. PubMed
2. Thiriot A et al. 2017. BMC biology. 15(1):45 . PubMed
3. Bowers E, et al. 2018. Nat Med. 24:95. PubMed
4. Kunimoto H, et al. 2018. Cancer Cell. 33:44. PubMed
5. Cong J et al. 2018. Cell metabolism. 28(2):243-255 . PubMed
6. Fan MY et al. 2018. Cell reports. 25(5):1204-1213 . PubMed
7. Nakamura‐Ishizu A et al. 2018. Cell reports. 25(7):1772-1785 . PubMed
8. Xu M et al. 2018. Immunity. 48(4):787-798 . PubMed
9. Hayatsu N et al. 2017. Immunity. 47(2):268-283 . PubMed
10. Glodde N et al. 2017. Immunity. 47(4):789-802 . PubMed
11. Mann M, et al. 2018. Cell Rep. 25:2992. PubMed
12. LaFleur MW, et al. 2019. Nat Commun. 10:1668. PubMed
13. Bitschar K, et al. 2019. Nat Commun. 10:2730. PubMed
14. Li C, et al. 2018. Cell. 174:285. PubMed
15. Tan DQ, et al. 2019. Cell Rep. 26:2316. PubMed
16. Katagiri T, et al. 2019. Mucosal Immunol. 12:p1104. PubMed
17. Yang BH, et al. 2020. Cell Reports. 27(12):3629-3645.e6.. PubMed
18. Peloquin GL, et al. 2019. Respir Res. 20:123. PubMed
19. Mintz MA, et al. 2019. Immunity. 51:310. PubMed
20. Clemente–Casares X, et al. 2017. Immunity. 47:974. PubMed
21. Niven J, et al. 2019. Cell Rep. 28:21. PubMed
22. Xueyang Yu et al. 2017. Immunity. 47(5):903-912 . PubMed
23. Codina A, et al. 2019. Cell Syst. 8:136. PubMed
24. Chen Z et al. 2019. Immunity. 51(5):840-855 . PubMed
25. Zhou J, et al. 2019. Immunity. 50:403. PubMed
26. Baryawno N et al. 2019. Cell. 177(7):1915-1932 . PubMed
27. Kaplan BLF et al. 2018. Current protocols in toxicology. 75:11:00 25. PubMed
28. Oliveira AC et al. 2017. eLife. 6 pii: e30883. PubMed
29. Poh AR, et al. 2017. Cancer Cell. 31:563. PubMed
30. LaFleur MW, et al. 2019. Nat Immunol. 20:1335. PubMed
31. Ajith A, et al. 2019. FASEB J. 33:5220. PubMed
32. Jackson-Jones LH, et al. 2020. Immunity. 52:700. PubMed
33. Wang W, et al. 2020. Immunity. 51(6):1102-1118.e7.. PubMed
34. Leruste A, et al. 2020. Cancer Cell. 36(6):597-612.e8.. PubMed
35. Viny AD, et al. 2019. Cell Stem Cell. 25:682. PubMed
36. Fukushima T, et al. 2019. Cell Rep. 29:4144. PubMed
37. Béguelin W, et al. 2020. Cancer Cell. 37(5):655-673. PubMed
38. Doo DW, et al. 2020. Ther Adv Med Oncol. 12:1758835920913798. PubMed
39. Gravano D, et al. 2010. PLoS One. 5:e13528. PubMed
40. Kang S, et al. 2011. J Exp Med. 208:747. PubMed
41. Li H, et al. 2011. Blood. 117:697. PubMed
42. Tran I, et al. 2013. J Clin Invest. 123:1590. PubMed
43. Bretz N, et al. 2014. Immunol Lett. 161:140. PubMed
44. White C, et al. 2015. J Immunol. 194:697. PubMed
45. Schaffert S, et al. 2015. J Immunol. 195: 1470-1479. PubMed
46. Siggs O, et al. 2015. Proc Natl Acad Sci U S A. 112: E5706 – E5714. PubMed
47. Li J, et al. 2020. Elife. 9:00. PubMed
48. Laubreton D, et al. 2020. Viruses. 12:00. PubMed
49. Si Y, et al. 2020. Sci Adv. 6:eaba0995. PubMed
50. Xu C, et al. 2020. Immunity. 53(2):417-428.e4. PubMed
51. Effern M, et al. 2020. Immunity. 53(3):564-580.e9. PubMed
52. Chang D, et al. 2020. Immunity. 53(3):614-626.e4. PubMed
53. Chakraborty M, et al. 2021. Cell Reports. 34(2):108609. PubMed
54. Xu W, et al. 2021. Immunity. 54(3):526-541.e7. PubMed
55. Chen Z, et al. 2021. Cell. 184(5):1262-1280.e22. PubMed
56. Kenswil KJG, et al. 2021. Cell Stem Cell. 28(4):653-670.e11. PubMed
57. Delacher M, et al. 2021. Immunity. 54(4):702-720.e17. PubMed
58. Paiva RA, et al. 2021. Cell Reports. 35(2):108967. PubMed
59. Huang J, et al. 2021. Immunity. 54(4):673-686.e4. PubMed
60. McLane LM, et al. 2021. Cell Reports. 35(6):109120. PubMed
61. Iturri L, et al. 2021. Immunity. . PubMed
62. Marangoni F, et al. 2021. Cell. . PubMed

RRID

AB_830788 (BioLegend Cat. No. 109823)
AB_830789 (BioLegend Cat. No. 109824)

Antigen Details

Structure

Protein tyrosine phosphatase (PTP) family, 180-240 kD

Distribution

All hematopoietic cells except mature erythrocytes and platelets of the CD45.2 strain of mice

Function

Phosphatase, T and B cell activation

Ligand/Receptor

Galectin-1, CD2, CD3, CD4

Biology Area

Cell Biology, Immunology, Inhibitory Molecules, Innate Immunity, Neuroscience, Neuroscience Cell Markers

Molecular Family

CD Molecules

Antigen References

1. Suzuki K, et al. 2000. Immunity 13:691.

Gene ID

19264 View all products for this Gene ID

UniProt

View information about CD45.2 on UniProt.org

Related Products

Related FAQs

There are no FAQs for this product.

Other Formats

View All CD45.2 Reagents Request Custom Conjugation

Pricing & Availability

Clone

104 (See other available formats)

Regulatory Status

RUO

Other Names

Ly-5.2, LCA

Isotype

Mouse (SJL) IgG2a, κ

Ave. Rating

Submit a Review

Product Citations

publications

• 

Compare all formats See APC/Fire™ 750 spectral data

Technical data sheet

Product Details

Reactivity

Mouse

Antibody Type

Monoclonal

Host Species

Mouse

Immunogen

B10.S mouse thymocytes and splenocytes

Formulation

Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide.

Preparation

The antibody was purified by affinity chromatography and conjugated with APC/Fire™ 750 under optimal conditions.

Concentration

0.2 mg/ml

Storage & Handling

The antibody solution should be stored undiluted between 2°C and 8°C, and protected from prolonged exposure to light. Do not freeze.

Application

FC – Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis

Application Notes

The 104 antibody does not react with mouse cells expressing the CD45.1 alloantigen. Additional reported applications (for the relevant formats) include: immunoprecipitation⁴, in vivo and in vitro blocking of B cell responses^1,2, and immunohistochemical staining of acetone-fixed frozen sections³. 

Application References

(PubMed link indicates BioLegend citation)

1. Yakura H, et al. 1983. J. Exp. Med. 157:1077. (Block)
2. Yakura H, et al. 1986. J. Immunol. 136:2729. (Block)
3. Suzuki K, et al. 2000. Immunity 13:691. (IHC)
4. Shen FW, et al. 1986. Immunogenetics 24:146. (IP)
5. Baldwin TA and Hogquist KA. 2007. J. Immunol. 179:837.
6. Pascal V, et al. 2007. J. Immunol. 179:1751.
7. Burman AC, et al. 2007. Blood 110:1064.
8. Kincaid EZ, et al. 2007. J. Immunol. 179:3187.
9. Phan TG, et al. 2007. Nature Immunol. 8:992.
10. Nakano-Yokomizo T, et al. 2011. J. Exp Med. 208:1661. PubMed
11. Wen T, et al. 2013. PNAS. 110:6067. PubMed
12. Kohlmeier JE, et al. 2008. Immunity. 29:101. (FC) PubMed

RRID

AB_2629722 (BioLegend Cat. No. 109851)
AB_2629723 (BioLegend Cat. No. 109852)

Antigen Details

Structure

Protein tyrosine phosphatase (PTP) family, 180-240 kD

Distribution

All hematopoietic cells except mature erythrocytes and platelets of the CD45.2 strain of mice

Function

Phosphatase, T and B cell activation

Ligand/Receptor

Galectin-1, CD2, CD3, CD4

Biology Area

Cell Biology, Immunology, Inhibitory Molecules, Innate Immunity, Neuroscience, Neuroscience Cell Markers

Molecular Family

CD Molecules

Antigen References

1. Suzuki K, et al. 2000. Immunity 13:691.

Gene ID

19264 View all products for this Gene ID

UniProt

View information about CD45.2 on UniProt.org

Related Products

Related FAQs

There are no FAQs for this product.

Other Formats

View All CD45.2 Reagents Request Custom Conjugation

Pricing & Availability

Clone

104 (See other available formats)

Regulatory Status

RUO

Other Names

Ly-5.2, LCA

Isotype

Mouse (SJL) IgG2a, κ

Ave. Rating

Submit a Review

Product Citations

publications

• 

Compare all formats

Technical data sheet

Product Details

Reactivity

Mouse

Antibody Type

Monoclonal

Host Species

Mouse

Immunogen

B10.S mouse thymocytes and splenocytes

Formulation

Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide.

Preparation

The antibody was purified by affinity chromatography, and conjugated with biotin under optimal conditions.

Concentration

0.5 mg/ml

Storage & Handling

The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

Application

FC – Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis⁶ cells in 100 µl volume. It is recommended that the reagent be titrated for optimal performance for each application.

Application Notes

The 104 antibody does not react with mouse cells expressing the CD45.1 alloantigen. Additional reported applications (for the relevant formats) include: immunoprecipitation⁴, in vivo and in vitro blocking of B cell responses^1,2, and immunohistochemical staining of acetone-fixed frozen sections³. 

Application References

(PubMed link indicates BioLegend citation)

1. Yakura H, et al. 1983. J. Exp. Med. 157:1077. (Block)
2. Yakura H, et al. 1986. J. Immunol. 136:2729. (Block)
3. Suzuki K, et al. 2000. Immunity 13:691. (IHC)
4. Shen FW, et al. 1986. Immunogenetics 24:146. (IP)
5. Baldwin TA and Hogquist KA. 2007. J. Immunol. 179:837.
6. Pascal V, et al. 2007. J. Immunol. 179:1751.
7. Burman AC, et al. 2007. Blood 110:1064.
8. Kincaid EZ, et al. 2007. J. Immunol. 179:3187.
9. Phan TG, et al. 2007. Nature Immunol. 8:992.
10. Nakano-Yokomizo T, et al. 2011. J. Exp Med. 208:1661. PubMed
11. Wen T, et al. 2013. PNAS. 110:6067. PubMed
12. Kohlmeier JE, et al. 2008. Immunity. 29:101. (FC) PubMed

Product Citations

1. Maroni G, et al. 2019. Int J Mol Sci. 20. PubMed
2. Wolock SL, et al. 2019. Cell Rep. 28:302. PubMed
3. Säwen P et al. 2018. eLife. 7 pii: e41258. PubMed
4. Kopinke D et al. 2017. Cell. 170(2):340-351 . PubMed
5. Mishra BB, et al. 2017. Nat Microbiol. 2:17072. PubMed
6. Yang K, et al. 2018. J Virol. 92:e00428. PubMed
7. Bromley SK, et al. 2020. Cell Reports. 32(9):108085. PubMed
8. McLelland B, et al. 2011. J Immunol Methods. 367:85. PubMed
9. Huang D, et al. 2020. Nat Commun. 4.520833333. PubMed
10. Zhao L, et al. 2020. EBioMedicine. 60:103020. PubMed

RRID

AB_313440 (BioLegend Cat. No. 109803)
AB_313441 (BioLegend Cat. No. 109804)

Antigen Details

Structure

Protein tyrosine phosphatase (PTP) family, 180-240 kD

Distribution

All hematopoietic cells except mature erythrocytes and platelets of the CD45.2 strain of mice

Function

Phosphatase, T and B cell activation

Ligand/Receptor

Galectin-1, CD2, CD3, CD4

Biology Area

Cell Biology, Immunology, Inhibitory Molecules, Innate Immunity, Neuroscience, Neuroscience Cell Markers

Molecular Family

CD Molecules

Antigen References

1. Suzuki K, et al. 2000. Immunity 13:691.

Gene ID

19264 View all products for this Gene ID

UniProt

View information about CD45.2 on UniProt.org

Related Products

Related FAQs

How many biotin molecules are per antibody structure?

We don't routinely measure the number of biotins with our antibody products but the number of biotin molecules range from 3-6 molecules per antibody.

Other Formats

View All CD45.2 Reagents Request Custom Conjugation