Pricing & Availability
- Clone
- 10.1 (See other available formats)
- Regulatory Status
- RUO
- Workshop
- VI MA36
- Other Names
- FcγRI, FcR I
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- AAGTATGCCCTACGA
- Ave. Rating
- Submit a Review
- Product Citations
- publications
| Cat # | Size | Price | Quantity Check Availability | Save | ||
|---|---|---|---|---|---|---|
| 305051 | 10 µg | $325.00 | ||||
CD64 is a 72 kD single chain type I glycoprotein also known as FcγRI and FcR I. CD64 is a member of the immunoglobulin superfamily and is expressed on monocytes/macrophages, dendritic cells, and activated granulocytes. The expression can be upregulated by IFN-γ stimulation. CD64 binds IgG immune complex. It plays a role in antigen capture, phagocytosis of IgG/antigen complexes, and antibody-dependent cellular cytotoxicity (ADCC).
Product Details
Technical data sheet
Product Details
- Reactivity
- Human, Baboon, Capuchin Monkey, Chimpanzee, Cynomolgus, Rhesus, Squirrel Monkey
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Human rheumatoid synovial fluid cells and fibronectin-purified monocytes.
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
- Preparation
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG – Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis for simultaneous detection of DNA and Protein.
- Application Notes
-
Clone 10.1 recognizes the EC3 epitope of CD64. While both contain the EC3 domain, in-house testing suggests that clone 10.1 preferentially binds to CD64A (FcγRIA), but not CD64B (FcγRIB). Additional reported applications (for the relevant formats) include: blocking of human IgG3 and murine IgG2a binding to FcγRI2,5,6,11 and immunohistochemical staining of acetone-fixed frozen tissue sections12.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes.
- Application References
(PubMed link indicates BioLegend citation)
-
- McMichael A, et al. Eds. 1987. Leucocyte Typing III. Oxford University Press. New York.
- Schlossman S, et al. Eds. 1995. Leucocyte Typing V. Oxford University Press. New York. p. 874.
- Kishimoto T, et al. Eds. 1997. Leucocyte Typing VI. Garland Publishing Inc. London.
- Holl V, et al. 2004. J. Immunol. 173:6274.
- Hober D, et al. 2002. J. Gen. Virol. 83:2169.
- Cho HJ, et al. 2007. Physiol Genomics 149:60.
- van Tits L, et al. 2005. Arterioscler Thromb Vasc Biol. 25:717. PubMed
- Bruhns P, et al. 2008. Blood 113:3716. PubMed
- Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
- Carter DL, et al. 1999. Cytometry 37:41. (FC)
- Dougherty GJ, et al. 1987. Eur. J. Immunol. 17:1453.
- Blom AB, et al. 2003. Arthritis Rheum. 48(4):1002-14. (IHC)
- RRID
- AB_2892360 (BioLegend Cat. No. 305051)
Antigen Details
- Structure
- Ig superfamily, type I glycoprotein, 72 kD
- Distribution
-
Monocytes, macrophages, dendritic cells, activated granulocytes
- Function
- Phagocytosis, ADCC
- Ligand/Receptor
- IgG receptor
- Cell Type
- Dendritic cells, Granulocytes, Macrophages, Monocytes
- Biology Area
- Immunology, Innate Immunity
- Molecular Family
- CD Molecules, Fc Receptors
- Antigen References
-
1. Hulett M, et al. 1994. Adv. Immunol. 57:1.
2. van de Winkel J, et al. 1993. Immunol. Today 14:215. - Gene ID
- 2209 View all products for this Gene ID
- UniProt
- View information about CD64 on UniProt.org
Related Products
| Description | Clone | Applications |
|---|
Related FAQs
- Is our human Trustain FcX™ (cat# 422302) compatible with anti human CD16, CD32 and CD64 clones 3G8, FUN-2 and 10.1 respectively?
-
Yes
Other Formats
View All CD64 Reagents Request Custom Conjugation
| Description | Clone | Applications |
|---|---|---|
| Biotin anti-human CD64 | 10.1 | FC |
| FITC anti-human CD64 | 10.1 | FC |
| PE anti-human CD64 | 10.1 | FC |
| Purified anti-human CD64 | 10.1 | FC, IHC-F, Block |
| Alexa Fluor® 488 anti-human CD64 | 10.1 | FC |
| Alexa Fluor® 647 anti-human CD64 | 10.1 | FC |
| APC anti-human CD64 | 10.1 | FC |
| Pacific Blue™ anti-human CD64 | 10.1 | FC |
| Brilliant Violet 421™ anti-human CD64 | 10.1 | FC |
| PE/Cyanine7 anti-human CD64 | 10.1 | FC |
| PerCP/Cyanine5.5 anti-human CD64 | 10.1 | FC |
| APC/Cyanine7 anti-human CD64 | 10.1 | FC |
| Brilliant Violet 510™ anti-human CD64 | 10.1 | FC |
| Purified anti-human CD64 (Maxpar® Ready) | 10.1 | FC, CyTOF® |
| PE/Dazzle™ 594 anti-human CD64 | 10.1 | FC |
| Brilliant Violet 605™ anti-human CD64 | 10.1 | FC |
| APC/Fire™ 750 anti-human CD64 | 10.1 | FC |
| PE anti-human CD64 | 10.1 | FC |
| PE/Dazzle™ 594 anti-human CD64 | 10.1 | FC |
| FITC anti-human CD64 | 10.1 | FC |
| TotalSeq™-A0162 anti-human CD64 | 10.1 | PG |
| Brilliant Violet 711™ anti-human CD64 | 10.1 | FC |
| Alexa Fluor® 700 anti-human CD64 | 10.1 | FC |
| Brilliant Violet 785™ anti-human CD64 | 10.1 | FC |
| TotalSeq™-C0162 anti-human CD64 | 10.1 | PG |
| Ultra-LEAF™ Purified anti-human CD64 | 10.1 | FC, IHC-F, Block |
| TotalSeq™-B0162 anti-human CD64 | 10.1 | PG |
| TotalSeq™-D0162 anti-human CD64 | 10.1 | PG |
| GMP PE anti-human CD64 | 10.1 | FC |
| GMP FITC anti-human CD64 | 10.1 | FC |